Transcript: Mouse XM_006503865.2

PREDICTED: Mus musculus solute carrier family 30 (zinc transporter), member 3 (Slc30a3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc30a3 (22784)
Length:
1923
CDS:
240..1259

Additional Resources:

NCBI RefSeq record:
XM_006503865.2
NBCI Gene record:
Slc30a3 (22784)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503865.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079589 GCCAATCTGCTAATGGCCTTT pLKO.1 660 CDS 100% 4.050 5.670 N Slc30a3 n/a
2 TRCN0000079590 CCGCCTGCTTCATAGTGACTA pLKO.1 590 CDS 100% 4.950 3.960 N Slc30a3 n/a
3 TRCN0000079592 ACACTTCGAGATGTTCTCCTT pLKO.1 942 CDS 100% 2.640 1.848 N Slc30a3 n/a
4 TRCN0000079591 GCCCACTTGCTAGCAGACATA pLKO.1 411 CDS 100% 4.950 2.970 N Slc30a3 n/a
5 TRCN0000038346 TCATCTACTTCAAGCCTCAAT pLKO.1 856 CDS 100% 4.950 3.465 N SLC30A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503865.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.