Transcript: Mouse XM_006503905.3

PREDICTED: Mus musculus SH3 domain and tetratricopeptide repeats 1 (Sh3tc1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sh3tc1 (231147)
Length:
3413
CDS:
293..3283

Additional Resources:

NCBI RefSeq record:
XM_006503905.3
NBCI Gene record:
Sh3tc1 (231147)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503905.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217607 GAATGAGCTGGTGGACTTATA pLKO.1 2527 CDS 100% 13.200 18.480 N Sh3tc1 n/a
2 TRCN0000251115 TCGGCTCTGGATTACACTAAA pLKO_005 2414 CDS 100% 13.200 18.480 N Sh3tc1 n/a
3 TRCN0000251117 TTTGATGCAGCTGGGTATTAC pLKO_005 3032 CDS 100% 13.200 18.480 N Sh3tc1 n/a
4 TRCN0000217082 CCTGACTACTGTGTACCTAAA pLKO.1 1075 CDS 100% 10.800 8.640 N Sh3tc1 n/a
5 TRCN0000216793 GCAGGGAAGATCTACTATATC pLKO.1 2498 CDS 100% 13.200 9.240 N Sh3tc1 n/a
6 TRCN0000265272 GCAGGGAAGATCTACTATATC pLKO_005 2498 CDS 100% 13.200 9.240 N Sh3tc1 n/a
7 TRCN0000175331 CCAGGAGTGTGTTATGATGAA pLKO.1 1852 CDS 100% 4.950 3.465 N Sh3tc1 n/a
8 TRCN0000194533 GCTGACATTTATGGCCGGAAA pLKO.1 1391 CDS 100% 4.050 2.835 N Sh3tc1 n/a
9 TRCN0000251116 ATGGGATCCCATCGATGAATC pLKO_005 162 5UTR 100% 10.800 6.480 N Sh3tc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503905.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.