Transcript: Mouse XM_006504037.3

PREDICTED: Mus musculus TBC1 domain family, member 1 (Tbc1d1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d1 (57915)
Length:
5567
CDS:
528..4016

Additional Resources:

NCBI RefSeq record:
XM_006504037.3
NBCI Gene record:
Tbc1d1 (57915)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504037.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111171 CCGAGCAGATATGAAGATTAT pLKO.1 2544 CDS 100% 13.200 18.480 N Tbc1d1 n/a
2 TRCN0000111174 CGCACTGATTGACGAGTGTAT pLKO.1 1097 CDS 100% 4.950 6.930 N Tbc1d1 n/a
3 TRCN0000111173 GCCACGGTAGAGAAACTTCTT pLKO.1 3846 CDS 100% 4.950 6.930 N Tbc1d1 n/a
4 TRCN0000315556 GCCACGGTAGAGAAACTTCTT pLKO_005 3846 CDS 100% 4.950 6.930 N Tbc1d1 n/a
5 TRCN0000304917 CAGGGATCAGAGGTCATATTT pLKO_005 3486 CDS 100% 15.000 10.500 N Tbc1d1 n/a
6 TRCN0000311163 TATCGGCCAGACATGATTATT pLKO_005 3285 CDS 100% 15.000 10.500 N Tbc1d1 n/a
7 TRCN0000304916 GAAGAGACTGTGCACCATTAA pLKO_005 4026 3UTR 100% 13.200 9.240 N Tbc1d1 n/a
8 TRCN0000111172 CGTGTCTTAAAGAAGTCACTA pLKO.1 2803 CDS 100% 4.950 3.465 N Tbc1d1 n/a
9 TRCN0000308376 CGTGTCTTAAAGAAGTCACTA pLKO_005 2803 CDS 100% 4.950 3.465 N Tbc1d1 n/a
10 TRCN0000111170 GAGGCAGAGAAGAGAGAACTT pLKO.1 4083 3UTR 100% 4.950 2.970 N Tbc1d1 n/a
11 TRCN0000147724 GTGACAACCAAAGAATGGATA pLKO.1 3733 CDS 100% 4.950 3.465 N TBC1D1 n/a
12 TRCN0000318878 GTGACAACCAAAGAATGGATA pLKO_005 3733 CDS 100% 4.950 3.465 N TBC1D1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504037.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.