Transcript: Mouse XM_006504120.2

PREDICTED: Mus musculus regulator of G-protein signaling 12 (Rgs12), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rgs12 (71729)
Length:
4847
CDS:
239..4594

Additional Resources:

NCBI RefSeq record:
XM_006504120.2
NBCI Gene record:
Rgs12 (71729)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504120.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305173 TTGGACTAGATGCGAGTATTT pLKO_005 891 CDS 100% 13.200 18.480 N Rgs12 n/a
2 TRCN0000037204 CGCCTTTCAAAGAGAGAAGAA pLKO.1 3725 CDS 100% 4.950 3.960 N Rgs12 n/a
3 TRCN0000309030 CGCCTTTCAAAGAGAGAAGAA pLKO_005 3725 CDS 100% 4.950 3.960 N Rgs12 n/a
4 TRCN0000305108 AGGCAAGTCTAACTCTATTAA pLKO_005 3667 CDS 100% 15.000 10.500 N Rgs12 n/a
5 TRCN0000305172 TGCCATGGTTGTGGGCTATTT pLKO_005 919 CDS 100% 13.200 9.240 N Rgs12 n/a
6 TRCN0000037208 CCTTTGGAAGATCTAGGAGAT pLKO.1 2184 CDS 100% 4.050 2.835 N Rgs12 n/a
7 TRCN0000037205 GCATGACAGTTTACAGGCTAT pLKO.1 979 CDS 100% 4.050 2.835 N Rgs12 n/a
8 TRCN0000037207 GCTTTCGGAATGCAGAACCTT pLKO.1 2054 CDS 100% 3.000 2.100 N Rgs12 n/a
9 TRCN0000423534 GAACACTAGGCAAGTCTAATT pLKO_005 3660 CDS 100% 13.200 9.240 N RGS12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504120.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.