Transcript: Mouse XM_006504563.3

PREDICTED: Mus musculus thyroid hormone receptor interactor 6 (Trip6), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trip6 (22051)
Length:
1768
CDS:
434..1654

Additional Resources:

NCBI RefSeq record:
XM_006504563.3
NBCI Gene record:
Trip6 (22051)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277330 CTCCCGCCTGAACACTGTTAT pLKO_005 578 CDS 100% 13.200 10.560 N Trip6 n/a
2 TRCN0000113518 GTCTGGATGCTGAGATAGATT pLKO.1 708 CDS 100% 5.625 4.500 N Trip6 n/a
3 TRCN0000113516 CTGGACCGTGTCTTCCATATT pLKO.1 1331 CDS 100% 13.200 9.240 N Trip6 n/a
4 TRCN0000277397 GATCCACTGCATTGAAGATTT pLKO_005 1597 CDS 100% 13.200 9.240 N Trip6 n/a
5 TRCN0000277329 GGGACCTTCTGGAGTACATAT pLKO_005 1120 CDS 100% 13.200 9.240 N Trip6 n/a
6 TRCN0000277331 TGGAGAGACTGACCAAGAAAC pLKO_005 1212 CDS 100% 10.800 7.560 N Trip6 n/a
7 TRCN0000113517 TGTCTTCCATATTGGTTGCTT pLKO.1 1339 CDS 100% 3.000 2.100 N Trip6 n/a
8 TRCN0000113515 CCCTGGAGAAATGTTCCACAT pLKO.1 1449 CDS 100% 4.050 2.430 N Trip6 n/a
9 TRCN0000061440 GTGAGAATTGTTGCTCTGGAT pLKO.1 1743 3UTR 100% 2.640 1.584 N TRIP6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.