Transcript: Mouse XM_006504585.2

PREDICTED: Mus musculus zinc finger, CW type with PWWP domain 1 (Zcwpw1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zcwpw1 (381678)
Length:
2193
CDS:
238..2046

Additional Resources:

NCBI RefSeq record:
XM_006504585.2
NBCI Gene record:
Zcwpw1 (381678)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504585.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251475 TCTAAGTACCACGTGACATTT pLKO_005 1276 CDS 100% 13.200 18.480 N Zcwpw1 n/a
2 TRCN0000202114 CGTCTAAGTACCACGTGACAT pLKO.1 1274 CDS 100% 4.950 6.930 N Zcwpw1 n/a
3 TRCN0000201281 GAACTCTTACCAGTGCAGAAT pLKO.1 515 CDS 100% 4.950 6.930 N Zcwpw1 n/a
4 TRCN0000216987 CAGAATCCAGATCCGAATTAT pLKO.1 1069 CDS 100% 15.000 12.000 N Zcwpw1 n/a
5 TRCN0000251473 CAGAATCCAGATCCGAATTAT pLKO_005 1069 CDS 100% 15.000 12.000 N Zcwpw1 n/a
6 TRCN0000267409 AGACTTCAGCCACCAACTTAT pLKO_005 1766 CDS 100% 13.200 7.920 N Zcwpw1 n/a
7 TRCN0000251474 CAGGGAGAGCCTCTCATTTCT pLKO_005 2079 3UTR 100% 5.625 3.375 N Zcwpw1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504585.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.