Transcript: Mouse XM_006504680.3

PREDICTED: Mus musculus adaptor-related protein complex 5, zeta 1 subunit (Ap5z1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ap5z1 (231855)
Length:
4559
CDS:
1092..3329

Additional Resources:

NCBI RefSeq record:
XM_006504680.3
NBCI Gene record:
Ap5z1 (231855)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504680.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177017 GCTGCTAACCTTACTAAAGAT pLKO.1 3164 CDS 100% 5.625 4.500 N Ap5z1 n/a
2 TRCN0000177256 GCTGTTACTCATTTCTGGATT pLKO.1 3576 3UTR 100% 4.950 3.960 N Ap5z1 n/a
3 TRCN0000177016 GAACAGATCAACAAGTTCTTT pLKO.1 2898 CDS 100% 5.625 3.938 N Ap5z1 n/a
4 TRCN0000182310 GCCTGCCACCAAGTAAATCTT pLKO.1 3946 3UTR 100% 5.625 3.938 N Ap5z1 n/a
5 TRCN0000177807 CTTACTAAAGATGCCCAGTGT pLKO.1 3173 CDS 100% 2.640 1.848 N Ap5z1 n/a
6 TRCN0000200369 GAGGTCATACACTTCTGCACA pLKO.1 2127 CDS 100% 2.640 1.848 N Ap5z1 n/a
7 TRCN0000200422 GCCTTTACCTACTGAGCCATT pLKO.1 3923 3UTR 100% 4.050 2.025 Y Ap5z1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504680.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.