Transcript: Mouse XM_006504801.3

PREDICTED: Mus musculus FMS-like tyrosine kinase 1 (Flt1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Flt1 (14254)
Length:
2881
CDS:
272..2866

Additional Resources:

NCBI RefSeq record:
XM_006504801.3
NBCI Gene record:
Flt1 (14254)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504801.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235425 ACGATCTTGCTGGGCATAAAG pLKO_005 1484 CDS 100% 13.200 18.480 N Flt1 n/a
2 TRCN0000235428 ATGGCTCAGGGTCGAAGTTAA pLKO_005 339 CDS 100% 13.200 18.480 N Flt1 n/a
3 TRCN0000009607 CGGAATCTTCAATCTACATAT pLKO.1 633 CDS 100% 13.200 18.480 N Flt1 n/a
4 TRCN0000009609 GCCTCAGATCACTTGGTTCAA pLKO.1 2341 CDS 100% 4.950 3.465 N Flt1 n/a
5 TRCN0000235427 ATTGAAGTCTGCTCGCTATTT pLKO_005 1405 CDS 100% 13.200 7.920 N Flt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504801.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.