Transcript: Mouse XM_006505020.3

PREDICTED: Mus musculus sarcoglycan, epsilon (Sgce), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sgce (20392)
Length:
1795
CDS:
100..1563

Additional Resources:

NCBI RefSeq record:
XM_006505020.3
NBCI Gene record:
Sgce (20392)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505020.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414575 ACCTGGATGGCTTCGATATAT pLKO_005 498 CDS 100% 15.000 21.000 N SGCE n/a
2 TRCN0000119310 GCCTACAATAGACGTACCTTT pLKO.1 604 CDS 100% 4.950 6.930 N Sgce n/a
3 TRCN0000119311 GCCTGTGATAACATGCGACAA pLKO.1 966 CDS 100% 4.050 5.670 N Sgce n/a
4 TRCN0000119307 CCCACTGTGTTGAGAACCAAA pLKO.1 1640 3UTR 100% 4.950 3.465 N Sgce n/a
5 TRCN0000056063 CGTTGCCATATCAAGCAGAAT pLKO.1 677 CDS 100% 4.950 3.465 N SGCE n/a
6 TRCN0000119308 GCCGAGACTATTACACGGATT pLKO.1 1136 CDS 100% 4.050 2.835 N Sgce n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505020.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07330 pDONR223 100% 76.9% 80.8% None (many diffs) n/a
2 ccsbBroad304_07330 pLX_304 0% 76.9% 80.8% V5 (many diffs) n/a
Download CSV