Transcript: Mouse XM_006505563.3

PREDICTED: Mus musculus lysophosphatidylcholine acyltransferase 3 (Lpcat3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lpcat3 (14792)
Length:
1867
CDS:
437..1474

Additional Resources:

NCBI RefSeq record:
XM_006505563.3
NBCI Gene record:
Lpcat3 (14792)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121440 CGAGGATCTGAGCCTTAACAA pLKO.1 186 5UTR 100% 5.625 7.875 N Lpcat3 n/a
2 TRCN0000121437 GCCAATCTACTACGATTGTAT pLKO.1 1721 3UTR 100% 0.563 0.450 N Lpcat3 n/a
3 TRCN0000121438 CCTACTATTCATATTGCCTTA pLKO.1 1402 CDS 100% 4.050 2.835 N Lpcat3 n/a
4 TRCN0000121439 GCCTACTATTCATATTGCCTT pLKO.1 1401 CDS 100% 2.640 1.848 N Lpcat3 n/a
5 TRCN0000129939 GCCTACTATTCATATTGCCTT pLKO.1 1401 CDS 100% 2.640 1.848 N LPCAT3 n/a
6 TRCN0000280675 GCCTACTATTCATATTGCCTT pLKO_005 1401 CDS 100% 2.640 1.848 N LPCAT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505563.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.