Transcript: Mouse XM_006505714.3

PREDICTED: Mus musculus zinc finger protein 638 (Zfp638), transcript variant X19, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp638 (18139)
Length:
4965
CDS:
989..4717

Additional Resources:

NCBI RefSeq record:
XM_006505714.3
NBCI Gene record:
Zfp638 (18139)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505714.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238261 ATCGAAAGAGGAACCATTATT pLKO_005 3406 CDS 100% 15.000 21.000 N Zfp638 n/a
2 TRCN0000238260 TCGAAGTCCAGTCCGTTATAT pLKO_005 352 5UTR 100% 15.000 21.000 N Zfp638 n/a
3 TRCN0000193598 GTCCAGTTGATTTGTGTATTT pLKO.1 4759 3UTR 100% 13.200 18.480 N Zfp638 n/a
4 TRCN0000238257 ATTCATTTAGGGTCCAGTTGA pLKO_005 4748 3UTR 100% 4.950 6.930 N Zfp638 n/a
5 TRCN0000174881 GCTGAACTAAAGGATTCAGAA pLKO.1 4442 CDS 100% 0.495 0.693 N Zfp638 n/a
6 TRCN0000238258 AGCCAAGCAGAATCCATTAAA pLKO_005 3490 CDS 100% 15.000 10.500 N Zfp638 n/a
7 TRCN0000174361 CCAGGAAGTTACATTGAAGAT pLKO.1 2684 CDS 100% 4.950 3.465 N Zfp638 n/a
8 TRCN0000174944 GAACTAATTGACCAAGATGAT pLKO.1 3755 CDS 100% 4.950 3.465 N Zfp638 n/a
9 TRCN0000193671 CCAAATCGAAAGAGGAACCAT pLKO.1 3402 CDS 100% 3.000 2.100 N Zfp638 n/a
10 TRCN0000216861 GAAAGTCCTTCAGGTACTTTG pLKO.1 1472 CDS 100% 1.080 0.756 N Zfp638 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505714.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.