Transcript: Mouse XM_006505757.3

PREDICTED: Mus musculus pleiotrophin (Ptn), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ptn (19242)
Length:
1309
CDS:
20..526

Additional Resources:

NCBI RefSeq record:
XM_006505757.3
NBCI Gene record:
Ptn (19242)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505757.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071675 TGACCTCAATACCGCCTTGAA pLKO.1 346 CDS 100% 4.950 6.930 N Ptn n/a
2 TRCN0000071674 GCTGCCTTCCTGGCATTGATT pLKO.1 62 CDS 100% 5.625 4.500 N Ptn n/a
3 TRCN0000317996 GCTGCCTTCCTGGCATTGATT pLKO_005 62 CDS 100% 5.625 4.500 N Ptn n/a
4 TRCN0000373341 TCAGCAAACAGGATCAGTTAA pLKO_005 561 3UTR 100% 13.200 9.240 N PTN n/a
5 TRCN0000071673 CCATGAAGACTCAGAGATGTA pLKO.1 255 CDS 100% 4.950 3.465 N Ptn n/a
6 TRCN0000317997 CCATGAAGACTCAGAGATGTA pLKO_005 255 CDS 100% 4.950 3.465 N Ptn n/a
7 TRCN0000071676 GCACAATGCTGACTGTCAGAA pLKO.1 397 CDS 100% 4.950 3.465 N Ptn n/a
8 TRCN0000317926 GCACAATGCTGACTGTCAGAA pLKO_005 397 CDS 100% 4.950 3.465 N Ptn n/a
9 TRCN0000071677 CGCCGAGTGCAAACAGACCAT pLKO.1 238 CDS 100% 0.880 0.616 N Ptn n/a
10 TRCN0000349473 CGCCGAGTGCAAACAGACCAT pLKO_005 238 CDS 100% 0.880 0.616 N Ptn n/a
11 TRCN0000002774 AGGCAAGAAACAGGAGAAGAT pLKO.1 496 CDS 100% 4.950 2.970 N PTN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505757.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.