Transcript: Mouse XM_006505876.3

PREDICTED: Mus musculus thromboxane A synthase 1, platelet (Tbxas1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbxas1 (21391)
Length:
1838
CDS:
17..1618

Additional Resources:

NCBI RefSeq record:
XM_006505876.3
NBCI Gene record:
Tbxas1 (21391)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505876.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076022 CTACACAAGTTCCGCTTTGAA pLKO.1 1505 CDS 100% 5.625 7.875 N Tbxas1 n/a
2 TRCN0000429032 TTATCATTTCCATCCATAATG pLKO_005 704 CDS 100% 13.200 10.560 N TBXAS1 n/a
3 TRCN0000076018 CGTGTGGAGATGGAGAGTTTA pLKO.1 1710 3UTR 100% 13.200 9.240 N Tbxas1 n/a
4 TRCN0000076019 CCATCCTACCTCCACATCTAA pLKO.1 967 CDS 100% 5.625 3.938 N Tbxas1 n/a
5 TRCN0000045331 GTTGAGAACTTCAGTAACTTT pLKO.1 317 CDS 100% 5.625 3.938 N TBXAS1 n/a
6 TRCN0000076021 CCAGAGGTGTTACTGCTGTTA pLKO.1 550 CDS 100% 4.950 3.465 N Tbxas1 n/a
7 TRCN0000222637 CCGTATCTGGACATGGTGATT pLKO.1 1187 CDS 100% 4.950 3.465 N Tbxas1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505876.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.