Transcript: Mouse XM_006506224.3

PREDICTED: Mus musculus ninjurin 2 (Ninj2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ninj2 (29862)
Length:
1050
CDS:
127..513

Additional Resources:

NCBI RefSeq record:
XM_006506224.3
NBCI Gene record:
Ninj2 (29862)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506224.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428603 TAGAGAACCAGAGGCATTTAA pLKO_005 368 CDS 100% 15.000 10.500 N Ninj2 n/a
2 TRCN0000438425 GACCTCCAGCAATCCTATTTG pLKO_005 492 CDS 100% 13.200 9.240 N Ninj2 n/a
3 TRCN0000437207 CTTCAAGGGCTACGAAGAAAC pLKO_005 610 3UTR 100% 10.800 7.560 N Ninj2 n/a
4 TRCN0000108454 GCCACCATCTTGGTCTTCATA pLKO.1 406 CDS 100% 5.625 3.938 N Ninj2 n/a
5 TRCN0000108451 GCTCTTTATGTCCAATGCCAT pLKO.1 207 CDS 100% 2.640 1.848 N Ninj2 n/a
6 TRCN0000108452 CCTTCTTGTGTTCATCGCCAT pLKO.1 330 CDS 100% 2.160 1.512 N Ninj2 n/a
7 TRCN0000108450 CCTGACTTGTCAGGATAACTA pLKO.1 564 3UTR 100% 0.563 0.394 N Ninj2 n/a
8 TRCN0000063775 CTGAACCTGAATGAGGTAGAA pLKO.1 352 CDS 100% 4.950 3.465 N NINJ2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506224.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.