Transcript: Mouse XM_006506271.3

PREDICTED: Mus musculus leiomodin 3 (fetal) (Lmod3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lmod3 (320502)
Length:
2107
CDS:
77..1792

Additional Resources:

NCBI RefSeq record:
XM_006506271.3
NBCI Gene record:
Lmod3 (320502)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506271.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090629 CCCAGAATGGTGGTAACGAAT pLKO.1 1253 CDS 100% 4.950 6.930 N Lmod3 n/a
2 TRCN0000090630 GCCTACCTTAAACCTGTGCAA pLKO.1 1751 CDS 100% 2.640 3.696 N Lmod3 n/a
3 TRCN0000090632 GACACATCAGAGACCAAAGAA pLKO.1 710 CDS 100% 5.625 3.938 N Lmod3 n/a
4 TRCN0000090628 GTTCACAGACAACACGTTCTT pLKO.1 1954 3UTR 100% 4.950 3.465 N Lmod3 n/a
5 TRCN0000090631 CCCACAGGAAACTTCAACCAT pLKO.1 260 CDS 100% 3.000 2.100 N Lmod3 n/a
6 TRCN0000434193 AGGAGGAGGAAGAAGATGAAG pLKO_005 558 CDS 100% 4.950 2.475 Y Myt1 n/a
7 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 554 CDS 100% 4.950 2.475 Y PTMA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506271.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.