Transcript: Mouse XM_006506326.3

PREDICTED: Mus musculus WEE1 homolog 2 (S. pombe) (Wee2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wee2 (381759)
Length:
2616
CDS:
392..2059

Additional Resources:

NCBI RefSeq record:
XM_006506326.3
NBCI Gene record:
Wee2 (381759)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506326.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361156 TACTTTGGCCTATGGATTAAG pLKO_005 2347 3UTR 100% 13.200 18.480 N Wee2 n/a
2 TRCN0000222258 CCACCATTGTTATTATCAGAT pLKO.1 1957 CDS 100% 4.950 6.930 N Wee2 n/a
3 TRCN0000026756 GCGTCCAATAATCACTTCCAA pLKO.1 1292 CDS 100% 3.000 4.200 N Wee2 n/a
4 TRCN0000360973 CATATTTGCCTTAGGATTAAC pLKO_005 1624 CDS 100% 13.200 9.240 N Wee2 n/a
5 TRCN0000360923 CTCCCGAAGCTCTAGACATAT pLKO_005 760 CDS 100% 13.200 9.240 N Wee2 n/a
6 TRCN0000361101 CTCTTTGTCTCTGGTCAATAT pLKO_005 817 CDS 100% 13.200 9.240 N Wee2 n/a
7 TRCN0000222259 CCAGAGATGAACTTCATACTT pLKO.1 561 CDS 100% 5.625 3.938 N Wee2 n/a
8 TRCN0000222260 GCAGAGTCTTTACCCATCAAT pLKO.1 1664 CDS 100% 5.625 3.938 N Wee2 n/a
9 TRCN0000222257 CCAGAGACTATCTTGAGGAAA pLKO.1 900 CDS 100% 4.950 3.465 N Wee2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506326.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.