Transcript: Mouse XM_006506554.2

PREDICTED: Mus musculus endoplasmic reticulum protein 27 (Erp27), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Erp27 (69187)
Length:
1227
CDS:
491..1078

Additional Resources:

NCBI RefSeq record:
XM_006506554.2
NBCI Gene record:
Erp27 (69187)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506554.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201219 GACAGAGTACAGTCCTATGAT pLKO.1 691 CDS 100% 5.625 7.875 N Erp27 n/a
2 TRCN0000200515 CCAAGATGTATCGTTTGGAAT pLKO.1 505 CDS 100% 4.950 6.930 N Erp27 n/a
3 TRCN0000249222 ATGATTGCAGCTGGCTTATTT pLKO_005 707 CDS 100% 15.000 12.000 N Erp27 n/a
4 TRCN0000249220 ACGACAGTTCCAAGATGTATC pLKO_005 496 CDS 100% 10.800 8.640 N Erp27 n/a
5 TRCN0000249221 CTGCCAGCTCTGGCCATTTAT pLKO_005 914 CDS 100% 15.000 10.500 N Erp27 n/a
6 TRCN0000217354 GGAAAGGTGATGTCCTATTTC pLKO.1 875 CDS 100% 13.200 9.240 N Erp27 n/a
7 TRCN0000265301 GGAAAGGTGATGTCCTATTTC pLKO_005 875 CDS 100% 13.200 9.240 N Erp27 n/a
8 TRCN0000257880 GCACTACCCAGGAACCCATAT pLKO_005 363 5UTR 100% 10.800 7.560 N Erp27 n/a
9 TRCN0000191992 GCTTCTTCCAGGATTTAGAAA pLKO.1 444 5UTR 100% 5.625 2.813 Y Erp27 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506554.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.