Transcript: Mouse XM_006506669.3

PREDICTED: Mus musculus SHQ1 homolog (S. cerevisiae) (Shq1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Shq1 (72171)
Length:
1675
CDS:
114..1490

Additional Resources:

NCBI RefSeq record:
XM_006506669.3
NBCI Gene record:
Shq1 (72171)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506669.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000215530 GAGTGAGGTTATCGATATTAA pLKO.1 614 CDS 100% 15.000 21.000 N Shq1 n/a
2 TRCN0000249246 TGAGTGAGGTTATCGATATTA pLKO_005 613 CDS 100% 15.000 21.000 N Shq1 n/a
3 TRCN0000249247 TCTACGCCAAGCCGTACTTTC pLKO_005 232 CDS 100% 10.800 15.120 N Shq1 n/a
4 TRCN0000192385 CGATCATTATCTAGCTGACTT pLKO.1 707 CDS 100% 4.950 6.930 N Shq1 n/a
5 TRCN0000190386 CCGATCATTATCTAGCTGACT pLKO.1 706 CDS 100% 2.640 3.696 N Shq1 n/a
6 TRCN0000249243 CTCAAGTGGTGCGCTCATTAC pLKO_005 1491 CDS 100% 10.800 8.640 N Shq1 n/a
7 TRCN0000190425 CCTATGAAGAGGTCTCAGAAA pLKO.1 517 CDS 100% 4.950 2.970 N Shq1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506669.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.