Transcript: Mouse XM_006506676.2

PREDICTED: Mus musculus zinc finger protein 248 (Zfp248), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp248 (72720)
Length:
3476
CDS:
178..1908

Additional Resources:

NCBI RefSeq record:
XM_006506676.2
NBCI Gene record:
Zfp248 (72720)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506676.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095209 GCCCTTAGTTTAGCAACTGTT pLKO.1 2342 3UTR 100% 4.950 6.930 N Zfp248 n/a
2 TRCN0000095212 CGTAGGGCATTGTGTTACTAA pLKO.1 315 CDS 100% 5.625 3.938 N Zfp248 n/a
3 TRCN0000095210 CCCAAGAGTATAAAGTGAGTA pLKO.1 1139 CDS 100% 4.950 3.465 N Zfp248 n/a
4 TRCN0000095213 CGGAAAGACGTTCTGTGTCAA pLKO.1 1491 CDS 100% 4.950 3.465 N Zfp248 n/a
5 TRCN0000095211 GCCACTCATGTTCACCAACAA pLKO.1 474 CDS 100% 4.950 3.465 N Zfp248 n/a
6 TRCN0000164599 CGGGAGAGAAACCCTATGAAT pLKO.1 1460 CDS 100% 5.625 2.813 Y ZNF570 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2767 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506676.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15944 pDONR223 0% 16.3% 15.3% None (many diffs) n/a
Download CSV