Transcript: Mouse XM_006506899.3

PREDICTED: Mus musculus phospholipase C, zeta 1 (Plcz1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plcz1 (114875)
Length:
3418
CDS:
192..2261

Additional Resources:

NCBI RefSeq record:
XM_006506899.3
NBCI Gene record:
Plcz1 (114875)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506899.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423266 GTTCCGAAACTTCCAATATTC pLKO_005 1382 CDS 100% 13.200 18.480 N Plcz1 n/a
2 TRCN0000097171 GCAATAAACAAGTATGCCTTT pLKO.1 906 CDS 100% 4.050 5.670 N Plcz1 n/a
3 TRCN0000434357 AGAGTCTATCAGCAATTTAAT pLKO_005 1404 CDS 100% 15.000 12.000 N Plcz1 n/a
4 TRCN0000417947 AGAGCCATTTACCGGTGTATT pLKO_005 396 CDS 100% 13.200 10.560 N Plcz1 n/a
5 TRCN0000414837 ATTGAAGGTTTCGCAAGATAC pLKO_005 606 CDS 100% 10.800 8.640 N Plcz1 n/a
6 TRCN0000097169 CCCTCGACATTGAGTGGAATA pLKO.1 1281 CDS 100% 10.800 8.640 N Plcz1 n/a
7 TRCN0000097173 CCTTATCTGATCTTGTCATTT pLKO.1 1345 CDS 100% 13.200 9.240 N Plcz1 n/a
8 TRCN0000097170 CCAAGATATGAATCATCCATT pLKO.1 677 CDS 100% 4.950 3.465 N Plcz1 n/a
9 TRCN0000097172 CCAGTTCTTTGCATGAACAAA pLKO.1 2025 CDS 100% 5.625 3.375 N Plcz1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506899.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.