Transcript: Mouse XM_006507189.3

PREDICTED: Mus musculus malic enzyme 3, NADP(+)-dependent, mitochondrial (Me3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Me3 (109264)
Length:
4345
CDS:
383..2197

Additional Resources:

NCBI RefSeq record:
XM_006507189.3
NBCI Gene record:
Me3 (109264)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507189.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114873 CGGTGACAGATAAGTTCGGAA pLKO.1 1179 CDS 100% 2.640 3.696 N Me3 n/a
2 TRCN0000114874 GTTCGGAATAAATTGCCTCAT pLKO.1 1192 CDS 100% 4.050 3.240 N Me3 n/a
3 TRCN0000114875 CCAACAATGAGGAGCTTCTTA pLKO.1 1077 CDS 100% 5.625 3.938 N Me3 n/a
4 TRCN0000114872 GCAGTCAAAGTCCTCGACTAT pLKO.1 2027 CDS 100% 4.950 3.465 N Me3 n/a
5 TRCN0000114871 CCCGTTAGATTTAATGTCTAA pLKO.1 2942 3UTR 100% 0.495 0.347 N Me3 n/a
6 TRCN0000064836 CTCCAGACTATGACTCCTTTA pLKO.1 2124 CDS 100% 10.800 7.560 N ME3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507189.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.