Transcript: Mouse XM_006507229.4

PREDICTED: Mus musculus serine/threonine kinase 33 (Stk33), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Stk33 (117229)
Length:
1961
CDS:
436..1761

Additional Resources:

NCBI RefSeq record:
XM_006507229.4
NBCI Gene record:
Stk33 (117229)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507229.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221230 CCACACATAAGAATGGACGAT pLKO.1 724 CDS 100% 2.640 3.696 N Stk33 n/a
2 TRCN0000221232 GAGTATTGGTAGTACAGAATT pLKO.1 564 CDS 100% 0.000 0.000 N Stk33 n/a
3 TRCN0000360780 TTGCATCAGCCATCGCATATC pLKO_005 1085 CDS 100% 10.800 8.640 N Stk33 n/a
4 TRCN0000221231 GCAAGACCAACCAATGTATTA pLKO.1 1588 CDS 100% 13.200 9.240 N Stk33 n/a
5 TRCN0000221233 CATCGCATATCTTCATAACAA pLKO.1 1095 CDS 100% 5.625 3.938 N Stk33 n/a
6 TRCN0000221229 GCAGTGTGACATTTGGAGCAT pLKO.1 1329 CDS 100% 2.640 1.848 N Stk33 n/a
7 TRCN0000360852 ATGTCACAGACATCGAGTATT pLKO_005 550 CDS 100% 13.200 7.920 N Stk33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507229.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.