Transcript: Mouse XM_006507408.3

PREDICTED: Mus musculus O-6-methylguanine-DNA methyltransferase (Mgmt), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mgmt (17314)
Length:
885
CDS:
88..786

Additional Resources:

NCBI RefSeq record:
XM_006507408.3
NBCI Gene record:
Mgmt (17314)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436311 TGAGCCGTCTGGCCGAAATTG pLKO_005 765 CDS 100% 4.400 6.160 N Mgmt n/a
2 TRCN0000039087 CTGGAAGCCTATTTCCGTGAA pLKO.1 358 CDS 100% 4.050 5.670 N Mgmt n/a
3 TRCN0000415155 TGACGGTGCCATCGGCCATTA pLKO_005 615 CDS 100% 3.600 5.040 N Mgmt n/a
4 TRCN0000022367 TTACCAGCAATTAGCAGCCCT pLKO.1 501 CDS 100% 0.660 0.924 N MGMT n/a
5 TRCN0000428115 GTGTTCCAGCAAGATTCATTC pLKO_005 424 CDS 100% 10.800 8.640 N Mgmt n/a
6 TRCN0000039086 ACGGTTTCTTACCAGCAATTA pLKO.1 493 CDS 100% 13.200 9.240 N Mgmt n/a
7 TRCN0000039085 GCTGCTGAAGGTTGTGAAATT pLKO.1 465 CDS 100% 13.200 9.240 N Mgmt n/a
8 TRCN0000436919 CAGTAGGAGGAGCAATGAGAA pLKO_005 548 CDS 100% 4.950 3.465 N Mgmt n/a
9 TRCN0000039088 GTAACCGTTTGAATGACACAT pLKO.1 787 CDS 100% 4.950 3.465 N Mgmt n/a
10 TRCN0000022365 TCTTACCAGCAATTAGCAGCC pLKO.1 499 CDS 100% 1.200 0.840 N MGMT n/a
11 TRCN0000022366 CTTACCAGCAATTAGCAGCCC pLKO.1 500 CDS 100% 0.540 0.378 N MGMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507408.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.