Transcript: Mouse XM_006507531.3

PREDICTED: Mus musculus zinc finger protein 143 (Zfp143), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp143 (20841)
Length:
3028
CDS:
48..2006

Additional Resources:

NCBI RefSeq record:
XM_006507531.3
NBCI Gene record:
Zfp143 (20841)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507531.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226336 CTGGATTGTTTGTCCTAATAC pLKO_005 2451 3UTR 100% 13.200 18.480 N Zfp143 n/a
2 TRCN0000257438 GATGATTAACACTCGGAATTA pLKO_005 1998 CDS 100% 13.200 18.480 N Zfp143 n/a
3 TRCN0000218650 GGACTCAACATGTCAACATAT pLKO_005 1603 CDS 100% 13.200 18.480 N Zfp143 n/a
4 TRCN0000086537 ACTGCTTACATACAGCATAAT pLKO.1 270 CDS 100% 13.200 10.560 N Zfp143 n/a
5 TRCN0000218118 CAATTGACCCAGATACCATTA pLKO_005 613 CDS 100% 10.800 8.640 N Zfp143 n/a
6 TRCN0000086536 GCTGTGGGAAACTCTATACAA pLKO.1 817 CDS 100% 5.625 3.938 N Zfp143 n/a
7 TRCN0000086535 CCCAGATACCATTAGTGCTTT pLKO.1 620 CDS 100% 4.950 3.465 N Zfp143 n/a
8 TRCN0000086534 CGGTGTAACAAGTACAGGAAT pLKO.1 680 CDS 100% 4.950 3.465 N Zfp143 n/a
9 TRCN0000086533 CCAGTGTTTGAAGCTGGGAAT pLKO.1 2634 3UTR 100% 4.050 2.835 N Zfp143 n/a
10 TRCN0000218464 ACAGGAGAAAGACCTTATTAC pLKO_005 1143 CDS 100% 13.200 7.920 N Zfp143 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507531.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.