Transcript: Mouse XM_006507535.3

PREDICTED: Mus musculus stromal interaction molecule 1 (Stim1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stim1 (20866)
Length:
3518
CDS:
171..2099

Additional Resources:

NCBI RefSeq record:
XM_006507535.3
NBCI Gene record:
Stim1 (20866)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507535.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358717 TGGTGGTGTCTATCGTTATTG pLKO_005 595 CDS 100% 13.200 18.480 N STIM1 n/a
2 TRCN0000193877 CCGAAACATCCATAAGCTGAT pLKO.1 152 5UTR 100% 4.050 3.240 N Stim1 n/a
3 TRCN0000193400 CCCTTCCTTTCTTTGCAATAT pLKO.1 2160 3UTR 100% 13.200 9.240 N Stim1 n/a
4 TRCN0000358719 GGCTGCTGGTTTGCCTATATC pLKO_005 624 CDS 100% 13.200 9.240 N STIM1 n/a
5 TRCN0000432705 GGCTGCTGGTTTGCCTATATC pLKO_005 624 CDS 100% 13.200 9.240 N Stim1 n/a
6 TRCN0000432414 ATGACATGGATGAGGAGATTG pLKO_005 1381 CDS 100% 10.800 7.560 N Stim1 n/a
7 TRCN0000443235 CACCTTCCATGGTGAGGATAA pLKO_005 266 CDS 100% 10.800 7.560 N Stim1 n/a
8 TRCN0000415880 GGATTCTTCCCATTCTCTTAG pLKO_005 1874 CDS 100% 10.800 7.560 N Stim1 n/a
9 TRCN0000439635 GGTGATACAGTGGCTCATTAC pLKO_005 356 CDS 100% 10.800 7.560 N Stim1 n/a
10 TRCN0000173765 CTGCGGTTTCCAGATTGTCAA pLKO.1 1256 CDS 100% 4.950 3.465 N Stim1 n/a
11 TRCN0000175139 GAAGACATTTATGGCGTTGAA pLKO.1 1781 CDS 100% 4.950 3.465 N Stim1 n/a
12 TRCN0000175008 GCAGTACTACAACATCAAGAA pLKO.1 1025 CDS 100% 4.950 3.465 N Stim1 n/a
13 TRCN0000217183 CTGGATGATGTGGATCATAAA pLKO.1 1152 CDS 100% 1.320 0.924 N Stim1 n/a
14 TRCN0000193789 CCAAGAAGACATTTATGGCGT pLKO.1 1777 CDS 100% 0.660 0.462 N Stim1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507535.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.