Transcript: Mouse XM_006507966.3

PREDICTED: Mus musculus zinc finger, RAN-binding domain containing 1 (Zranb1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zranb1 (360216)
Length:
4149
CDS:
485..2689

Additional Resources:

NCBI RefSeq record:
XM_006507966.3
NBCI Gene record:
Zranb1 (360216)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507966.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246109 TATTCTTAGACGACCAATTAT pLKO_005 2155 CDS 100% 15.000 21.000 N ZRANB1 n/a
2 TRCN0000348585 TATTCTTAGACGACCAATTAT pLKO_005 2155 CDS 100% 15.000 21.000 N Zranb1 n/a
3 TRCN0000030973 CGATATTGCTTACAGAGGTAT pLKO.1 1548 CDS 100% 4.950 6.930 N Zranb1 n/a
4 TRCN0000348535 GCAGGACATGTTAGCGATATT pLKO_005 1534 CDS 100% 13.200 10.560 N Zranb1 n/a
5 TRCN0000030971 CGTCTGCAATCAAGTGTACTA pLKO.1 618 CDS 100% 4.950 3.960 N Zranb1 n/a
6 TRCN0000348533 TGACCATCCCAGACCTAATAA pLKO_005 1078 CDS 100% 15.000 10.500 N Zranb1 n/a
7 TRCN0000348534 GTCTGGACAGTAGACTATATG pLKO_005 1842 CDS 100% 13.200 9.240 N Zranb1 n/a
8 TRCN0000030969 CCCAGACCTAATAACATTGAA pLKO.1 1085 CDS 100% 5.625 3.938 N Zranb1 n/a
9 TRCN0000073817 CCATAGAAGCATACAAGTCAT pLKO.1 1401 CDS 100% 4.950 3.465 N ZRANB1 n/a
10 TRCN0000030972 GCCTGCATGACTGTTCACATT pLKO.1 1968 CDS 100% 4.950 3.465 N Zranb1 n/a
11 TRCN0000335312 GCCTGCATGACTGTTCACATT pLKO_005 1968 CDS 100% 4.950 3.465 N Zranb1 n/a
12 TRCN0000030970 GCTAATCTGAACACTGATGAT pLKO.1 2372 CDS 100% 4.950 3.465 N Zranb1 n/a
13 TRCN0000073814 GCAGTAGTGGTAATAGCCAAA pLKO.1 1182 CDS 100% 4.050 2.835 N ZRANB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507966.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.