Transcript: Mouse XM_006508001.3

PREDICTED: Mus musculus RIKEN cDNA 2610020H08 gene (2610020H08Rik), transcript variant X24, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rexo5 (434234)
Length:
1667
CDS:
256..1572

Additional Resources:

NCBI RefSeq record:
XM_006508001.3
NBCI Gene record:
Rexo5 (434234)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508001.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268727 CTGTCGAAGGACCTCTAATTT pLKO_005 707 CDS 100% 15.000 21.000 N Rexo5 n/a
2 TRCN0000268776 ACTTTATCCTTACCAAGTATA pLKO_005 878 CDS 100% 13.200 18.480 N Rexo5 n/a
3 TRCN0000268777 ATGGACCTCCTTCGCATATTC pLKO_005 335 CDS 100% 13.200 18.480 N Rexo5 n/a
4 TRCN0000283792 GAACGTGGGCTTGACTAAATG pLKO_005 792 CDS 100% 13.200 18.480 N Rexo5 n/a
5 TRCN0000215825 CTTTATCCTTACCAAGTATAC pLKO.1 879 CDS 100% 10.800 15.120 N Rexo5 n/a
6 TRCN0000217850 GTATGCAGTTCTGGGTAAATC pLKO.1 453 CDS 100% 13.200 9.240 N Rexo5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508001.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.