Transcript: Mouse XM_006508013.1

PREDICTED: Mus musculus dickkopf WNT signaling pathway inhibitor 3 (Dkk3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dkk3 (50781)
Length:
3361
CDS:
123..1172

Additional Resources:

NCBI RefSeq record:
XM_006508013.1
NBCI Gene record:
Dkk3 (50781)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508013.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071751 AGCCATGAATGTATCATTGAT pLKO.1 552 CDS 100% 5.625 7.875 N Dkk3 n/a
2 TRCN0000071750 GCAAGCTTACCTCCCAACTAT pLKO.1 384 CDS 100% 5.625 3.938 N Dkk3 n/a
3 TRCN0000352103 GCAAGCTTACCTCCCAACTAT pLKO_005 384 CDS 100% 5.625 3.938 N Dkk3 n/a
4 TRCN0000071748 GCTACGCTCAATGAGATGTTT pLKO.1 255 CDS 100% 5.625 3.938 N Dkk3 n/a
5 TRCN0000352023 GCTACGCTCAATGAGATGTTT pLKO_005 255 CDS 100% 5.625 3.938 N Dkk3 n/a
6 TRCN0000071749 CCGGATGAGTACGAAGATGTT pLKO.1 1035 CDS 100% 4.950 3.465 N Dkk3 n/a
7 TRCN0000352025 CCGGATGAGTACGAAGATGTT pLKO_005 1035 CDS 100% 4.950 3.465 N Dkk3 n/a
8 TRCN0000071752 TCTGTGACAACCAGAGGGATT pLKO.1 742 CDS 100% 4.050 2.835 N Dkk3 n/a
9 TRCN0000352104 TCTGTGACAACCAGAGGGATT pLKO_005 742 CDS 100% 4.050 2.835 N Dkk3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508013.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.