Transcript: Mouse XM_006508028.2

PREDICTED: Mus musculus nucleobindin 2 (Nucb2), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nucb2 (53322)
Length:
3045
CDS:
304..1230

Additional Resources:

NCBI RefSeq record:
XM_006508028.2
NBCI Gene record:
Nucb2 (53322)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104606 GCGGATGCTCATCAAAGCTAA pLKO.1 645 CDS 100% 4.950 6.930 N Nucb2 n/a
2 TRCN0000331943 GCGGATGCTCATCAAAGCTAA pLKO_005 645 CDS 100% 4.950 6.930 N Nucb2 n/a
3 TRCN0000104605 CCAAAGTTAATCATCCCGGAA pLKO.1 956 CDS 100% 2.160 3.024 N Nucb2 n/a
4 TRCN0000104609 AGCACTATTCACAAGAGAGTT pLKO.1 1104 CDS 100% 4.950 3.465 N Nucb2 n/a
5 TRCN0000309481 AGCACTATTCACAAGAGAGTT pLKO_005 1104 CDS 100% 4.950 3.465 N Nucb2 n/a
6 TRCN0000104607 CCACCAGAATCCTAACACATT pLKO.1 732 CDS 100% 4.950 3.465 N Nucb2 n/a
7 TRCN0000309484 CCACCAGAATCCTAACACATT pLKO_005 732 CDS 100% 4.950 3.465 N Nucb2 n/a
8 TRCN0000104608 GCAAGGATAGAGCCACCAGAT pLKO.1 430 CDS 100% 4.050 2.835 N Nucb2 n/a
9 TRCN0000309483 GCAAGGATAGAGCCACCAGAT pLKO_005 430 CDS 100% 4.050 2.835 N Nucb2 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2972 3UTR 100% 4.950 2.475 Y KAAG1 n/a
11 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 2978 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508028.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.