Transcript: Mouse XM_006508115.2

PREDICTED: Mus musculus adipogenesis associated Mth938 domain containing (Aamdc), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Aamdc (66273)
Length:
741
CDS:
197..469

Additional Resources:

NCBI RefSeq record:
XM_006508115.2
NBCI Gene record:
Aamdc (66273)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006508115.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265052 CAGGCCGTGAAGGAGTATAAT pLKO_005 395 CDS 100% 15.000 21.000 N Aamdc n/a
2 TRCN0000191427 CCTTAACCTATAAGGATTGCA pLKO.1 255 CDS 100% 0.300 0.420 N Aamdc n/a
3 TRCN0000191201 CCTATAAGGATTGCAAAGTAT pLKO.1 261 CDS 100% 5.625 4.500 N Aamdc n/a
4 TRCN0000265053 TGCACTCCAGGTTGCTTAAAT pLKO_005 607 3UTR 100% 15.000 10.500 N Aamdc n/a
5 TRCN0000283270 AGGCTCTACCTTAACCTATAA pLKO_005 247 CDS 100% 13.200 9.240 N Aamdc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006508115.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03049 pDONR223 100% 66.6% 66.3% None (many diffs) n/a
Download CSV