Transcript: Mouse XM_006509230.2

PREDICTED: Mus musculus pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2 (Plekha2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Plekha2 (83436)
Length:
4964
CDS:
155..1432

Additional Resources:

NCBI RefSeq record:
XM_006509230.2
NBCI Gene record:
Plekha2 (83436)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509230.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193726 CGATGACTTTACCATCTGCTA pLKO.1 820 CDS 100% 2.640 3.696 N Plekha2 n/a
2 TRCN0000194541 GCCCACTTGCTCTTTGCTTTA pLKO.1 2520 3UTR 100% 10.800 7.560 N Plekha2 n/a
3 TRCN0000277295 GGCAAATTCCTCCGGAGATAC pLKO_005 221 CDS 100% 10.800 7.560 N Plekha2 n/a
4 TRCN0000216715 CTGGAAGTTCTACCCTTACAA pLKO.1 1107 CDS 100% 5.625 3.938 N Plekha2 n/a
5 TRCN0000173440 CGCCTAACTCCATCTTGTCAA pLKO.1 1131 CDS 100% 4.950 3.465 N Plekha2 n/a
6 TRCN0000277296 CGCCTAACTCCATCTTGTCAA pLKO_005 1131 CDS 100% 4.950 3.465 N Plekha2 n/a
7 TRCN0000174698 GCTAGGTAAATTAACCCTGTT pLKO.1 2925 3UTR 100% 4.050 2.835 N Plekha2 n/a
8 TRCN0000277294 GCTAGGTAAATTAACCCTGTT pLKO_005 2925 3UTR 100% 4.050 2.835 N Plekha2 n/a
9 TRCN0000173215 CAGCAAGATCACTGTACCCAA pLKO.1 487 CDS 100% 2.640 1.848 N Plekha2 n/a
10 TRCN0000277253 ACAACCTGTTTGAAATCATAA pLKO_005 945 CDS 100% 13.200 7.920 N Plekha2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509230.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.