Transcript: Mouse XM_006509312.3

PREDICTED: Mus musculus macrophage scavenger receptor 1 (Msr1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Msr1 (20288)
Length:
5729
CDS:
55..1419

Additional Resources:

NCBI RefSeq record:
XM_006509312.3
NBCI Gene record:
Msr1 (20288)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509312.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424638 ACGGAACGCTTCCAGAATTTC pLKO_005 466 CDS 100% 13.200 10.560 N Msr1 n/a
2 TRCN0000428572 TCGGGATCTCCTGGACCTAAA pLKO_005 1039 CDS 100% 10.800 8.640 N Msr1 n/a
3 TRCN0000072041 CGTGAATCTACAGCAAAGCAA pLKO.1 658 CDS 100% 3.000 2.400 N Msr1 n/a
4 TRCN0000072040 GCAACTGACCAAAGACTTAAT pLKO.1 493 CDS 100% 13.200 9.240 N Msr1 n/a
5 TRCN0000072039 GCAGTTCAGAATCCGTGAAAT pLKO.1 104 CDS 100% 13.200 9.240 N Msr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509312.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.