Transcript: Mouse XM_006509453.1

PREDICTED: Mus musculus a disintegrin and metallopeptidase domain 20 (Adam20), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adam20 (384806)
Length:
2573
CDS:
86..2368

Additional Resources:

NCBI RefSeq record:
XM_006509453.1
NBCI Gene record:
Adam20 (384806)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087508 CTGGTACTGATTACTCCAATT pLKO.1 2189 CDS 100% 10.800 15.120 N Adam20 n/a
2 TRCN0000087510 GCCCGTGGATAGAATGCAAAT pLKO.1 925 CDS 100% 10.800 15.120 N Adam20 n/a
3 TRCN0000087511 GTCTGTTAGGTCCTAATCTTT pLKO.1 1104 CDS 100% 5.625 7.875 N Adam20 n/a
4 TRCN0000087512 GAAGACTCTCAGCCTTAATAT pLKO.1 970 CDS 100% 15.000 10.500 N Adam20 n/a
5 TRCN0000087509 GAGTTGTGGAATGAAGGAAAT pLKO.1 899 CDS 100% 10.800 7.560 N Adam20 n/a
6 TRCN0000087576 CGAGTTCAGTAACTGTAGTTA pLKO.1 1249 CDS 100% 5.625 3.938 N LOC382006 n/a
7 TRCN0000087577 CAAATCCAGTTCTGTGGGAAT pLKO.1 1340 CDS 100% 4.050 2.835 N LOC382006 n/a
8 TRCN0000087574 GCACATGAGATTGGTCATAAT pLKO.1 1145 CDS 100% 13.200 6.600 Y LOC382006 n/a
9 TRCN0000032157 CCAGAGTCTATGGTTGCTATT pLKO.1 485 CDS 100% 10.800 5.400 Y Adam25 n/a
10 TRCN0000192245 CCAGAGTCTATGGTTGCTATT pLKO.1 485 CDS 100% 10.800 5.400 Y Adam39 n/a
11 TRCN0000032158 CCAGAAGTAGTGATACCCTTA pLKO.1 251 CDS 100% 4.050 2.025 Y Adam25 n/a
12 TRCN0000201046 CCAGAAGTAGTGATACCCTTA pLKO.1 251 CDS 100% 4.050 2.025 Y Adam39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.