Transcript: Mouse XM_006509655.3

PREDICTED: Mus musculus coiled-coil domain containing 124 (Ccdc124), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccdc124 (234388)
Length:
1220
CDS:
352..1005

Additional Resources:

NCBI RefSeq record:
XM_006509655.3
NBCI Gene record:
Ccdc124 (234388)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509655.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182010 CGCTGATGCCAAGAAACAGAA pLKO.1 426 CDS 100% 4.950 3.465 N Ccdc124 n/a
2 TRCN0000198906 GCCATAGGTCATCCTCAACAA pLKO.1 1108 3UTR 100% 4.950 3.465 N Ccdc124 n/a
3 TRCN0000181941 GCTGGAAGATGCTTACTGGAA pLKO.1 450 CDS 100% 2.640 1.848 N Ccdc124 n/a
4 TRCN0000198846 CAAGAAACAGAAGGAGCTGGA pLKO.1 435 CDS 100% 2.160 1.512 N Ccdc124 n/a
5 TRCN0000181879 GCCACTGGAAGAGAACCTTAA pLKO.1 714 CDS 100% 10.800 6.480 N Ccdc124 n/a
6 TRCN0000181504 GAAGGAGCTGGAAGATGCTTA pLKO.1 444 CDS 100% 4.950 2.970 N Ccdc124 n/a
7 TRCN0000181658 GAAACAGAAGGAGCTGGAAGA pLKO.1 438 CDS 100% 4.050 2.430 N Ccdc124 n/a
8 TRCN0000181793 GCTGATGCCAAGAAACAGAAG pLKO.1 427 CDS 100% 4.050 2.430 N Ccdc124 n/a
9 TRCN0000198590 CTTACTGGAAGGATGAGGACA pLKO.1 461 CDS 100% 2.640 1.584 N Ccdc124 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509655.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09412 pDONR223 100% 82.1% 87.4% None (many diffs) n/a
2 ccsbBroad304_09412 pLX_304 0% 82.1% 87.4% V5 (many diffs) n/a
Download CSV