Transcript: Mouse XM_006509754.3

PREDICTED: Mus musculus membrane-associated ring finger (C3HC4) 1 (March1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
March1 (72925)
Length:
4757
CDS:
292..1653

Additional Resources:

NCBI RefSeq record:
XM_006509754.3
NBCI Gene record:
March1 (72925)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509754.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430102 CATAAGGAATGGTTGGTACAC pLKO_005 1883 3UTR 100% 4.050 5.670 N March1 n/a
2 TRCN0000173561 GAGAAGAACTTCCCGTGTAAT pLKO.1 1528 CDS 100% 13.200 9.240 N March1 n/a
3 TRCN0000437536 GCCTGAAAGTGTGTGCGTTAT pLKO_005 2079 3UTR 100% 10.800 7.560 N March1 n/a
4 TRCN0000421732 GGTCCTTGTATGTGTTGATAG pLKO_005 1295 CDS 100% 10.800 7.560 N March1 n/a
5 TRCN0000176313 CGAAAGAAAGATGACCACATT pLKO.1 3237 3UTR 100% 4.950 3.465 N March1 n/a
6 TRCN0000175494 CCCTTGCATTAGAAACTACAT pLKO.1 2688 3UTR 100% 4.950 2.970 N March1 n/a
7 TRCN0000423956 TAATGGAGACCAAGCTCAAAC pLKO_005 1175 CDS 100% 10.800 7.560 N MARCHF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509754.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.