Transcript: Mouse XM_006509844.2

PREDICTED: Mus musculus glutamate receptor, ionotropic, AMPA4 (alpha 4) (Gria4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gria4 (14802)
Length:
5573
CDS:
493..3147

Additional Resources:

NCBI RefSeq record:
XM_006509844.2
NBCI Gene record:
Gria4 (14802)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509844.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103036 GCGAAACATATCGGTATCAAA pLKO.1 1855 CDS 100% 5.625 7.875 N Gria4 n/a
2 TRCN0000103038 CGCTGGAAGAAACTAGATCAA pLKO.1 1324 CDS 100% 4.950 6.930 N Gria4 n/a
3 TRCN0000420063 TTGCATCGGACCTACCATAAA pLKO_005 3295 3UTR 100% 13.200 10.560 N GRIA4 n/a
4 TRCN0000103039 AGTGGTTGTAACCACAATTAT pLKO.1 1740 CDS 100% 1.500 1.200 N Gria4 n/a
5 TRCN0000103035 GCCAGGGATCAACAGTTAATA pLKO.1 3664 3UTR 100% 15.000 10.500 N Gria4 n/a
6 TRCN0000103037 GCCTCCTGGATCACTATGAAT pLKO.1 923 CDS 100% 5.625 3.375 N Gria4 n/a
7 TRCN0000062986 GCTGAAACTTTCCGAAGTCTT pLKO.1 1417 CDS 100% 4.950 3.465 N GRIA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509844.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.