Transcript: Mouse XM_006509966.3

PREDICTED: Mus musculus CD3 antigen, epsilon polypeptide (Cd3e), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cd3e (12501)
Length:
1515
CDS:
150..719

Additional Resources:

NCBI RefSeq record:
XM_006509966.3
NBCI Gene record:
Cd3e (12501)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006509966.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068081 GCTTGCTGATGGTCATTTATT pLKO.1 523 CDS 100% 15.000 12.000 N Cd3e n/a
2 TRCN0000068079 GCTGCCTCAGAAGCATGATAA pLKO.1 323 CDS 100% 13.200 9.240 N Cd3e n/a
3 TRCN0000068080 GCAGTAGCCATAATCATCATT pLKO.1 480 CDS 100% 5.625 3.938 N Cd3e n/a
4 TRCN0000068078 GCCGAGAACATTGAATACAAA pLKO.1 219 CDS 100% 5.625 3.938 N Cd3e n/a
5 TRCN0000068082 CTCAGGAACCAGTGTAGAGTT pLKO.1 248 CDS 100% 4.950 3.465 N Cd3e n/a
6 TRCN0000057217 GACCTGTATTCTGGCCTGAAT pLKO.1 684 CDS 100% 4.950 3.465 N CD3E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006509966.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.