Transcript: Mouse XM_006510107.3

PREDICTED: Mus musculus roundabout guidance receptor 3 (Robo3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Robo3 (19649)
Length:
4897
CDS:
421..4632

Additional Resources:

NCBI RefSeq record:
XM_006510107.3
NBCI Gene record:
Robo3 (19649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510107.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100019 CCAGATGATAGATACTACAAT pLKO.1 3388 CDS 100% 5.625 7.875 N Robo3 n/a
2 TRCN0000100016 CCTGGGTAATGAAAGCCGATT pLKO.1 2853 CDS 100% 4.050 3.240 N Robo3 n/a
3 TRCN0000100017 GCTGGCATGTATATGTGCGTA pLKO.1 1111 CDS 100% 2.640 1.848 N Robo3 n/a
4 TRCN0000100018 GCCTGTACAAATGCCATCTTT pLKO.1 3639 CDS 100% 5.625 3.375 N Robo3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510107.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12461 pDONR223 100% 9.2% 9.1% None (many diffs) n/a
2 ccsbBroad304_12461 pLX_304 0% 9.2% 9.1% V5 (many diffs) n/a
Download CSV