Transcript: Mouse XM_006510224.3

PREDICTED: Mus musculus FAD-dependent oxidoreductase domain containing 1 (Foxred1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Foxred1 (235169)
Length:
2341
CDS:
740..1690

Additional Resources:

NCBI RefSeq record:
XM_006510224.3
NBCI Gene record:
Foxred1 (235169)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510224.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099146 GCTGGTTATTATGACTACAAT pLKO.1 1451 CDS 100% 5.625 7.875 N Foxred1 n/a
2 TRCN0000308913 GCTGGTTATTATGACTACAAT pLKO_005 1451 CDS 100% 5.625 7.875 N Foxred1 n/a
3 TRCN0000099148 TGGAGTATCAACCAGTAGAAT pLKO.1 1041 CDS 100% 5.625 7.875 N Foxred1 n/a
4 TRCN0000308974 TGGAGTATCAACCAGTAGAAT pLKO_005 1041 CDS 100% 5.625 7.875 N Foxred1 n/a
5 TRCN0000099149 CAGACATTAGTGGAGTCTATT pLKO.1 1239 CDS 100% 13.200 9.240 N Foxred1 n/a
6 TRCN0000308912 CAGACATTAGTGGAGTCTATT pLKO_005 1239 CDS 100% 13.200 9.240 N Foxred1 n/a
7 TRCN0000099145 GCACAGAACATTCTAGGATAA pLKO.1 2022 3UTR 100% 10.800 7.560 N Foxred1 n/a
8 TRCN0000308911 GCACAGAACATTCTAGGATAA pLKO_005 2022 3UTR 100% 10.800 7.560 N Foxred1 n/a
9 TRCN0000099147 CAGACCAAGTTTCCCTGGATA pLKO.1 791 CDS 100% 4.950 3.465 N Foxred1 n/a
10 TRCN0000308975 CAGACCAAGTTTCCCTGGATA pLKO_005 791 CDS 100% 4.950 3.465 N Foxred1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510224.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.