Transcript: Mouse XM_006510269.1

PREDICTED: Mus musculus E26 avian leukemia oncogene 1, 5' domain (Ets1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ets1 (23871)
Length:
4969
CDS:
120..1574

Additional Resources:

NCBI RefSeq record:
XM_006510269.1
NBCI Gene record:
Ets1 (23871)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510269.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365954 GCTTCGACTACGAGGATTATC pLKO_005 1105 CDS 100% 13.200 18.480 N Ets1 n/a
2 TRCN0000365878 CGTGGCCTTCGCTACTATTAT pLKO_005 1422 CDS 100% 15.000 12.000 N Ets1 n/a
3 TRCN0000379005 TGTTGGTTGGACTCTTCATTT pLKO_005 1641 3UTR 100% 13.200 9.240 N Ets1 n/a
4 TRCN0000374176 CATCAAGCAAGAGGTGTTAAC pLKO_005 926 CDS 100% 10.800 7.560 N Ets1 n/a
5 TRCN0000374240 CCTTGCAGACAGACTACTTTG pLKO_005 904 CDS 100% 10.800 7.560 N Ets1 n/a
6 TRCN0000042642 GCATCTAGAGATCCTGCAGAA pLKO.1 632 CDS 100% 4.050 2.835 N Ets1 n/a
7 TRCN0000365880 TGAAACCATATCAGGTTAATG pLKO_005 661 CDS 100% 13.200 7.920 N Ets1 n/a
8 TRCN0000005591 CTGGAATTACTCACTGATAAA pLKO.1 1275 CDS 100% 13.200 9.240 N ETS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510269.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10809 pDONR223 100% 48.9% 47.3% None (many diffs) n/a
2 ccsbBroad304_10809 pLX_304 0% 48.9% 47.3% V5 (many diffs) n/a
Download CSV