Transcript: Mouse XM_006510293.3

PREDICTED: Mus musculus olfactomedin 2 (Olfm2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Olfm2 (244723)
Length:
2115
CDS:
263..1699

Additional Resources:

NCBI RefSeq record:
XM_006510293.3
NBCI Gene record:
Olfm2 (244723)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510293.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444135 CAAGGTCTACTTTGCGTACTT pLKO_005 1504 CDS 100% 4.950 6.930 N Olfm2 n/a
2 TRCN0000127406 CGTCAGTAACCCTATTACCAT pLKO.1 934 CDS 100% 3.000 4.200 N Olfm2 n/a
3 TRCN0000127408 GCGTCAGTAACCCTATTACCA pLKO.1 933 CDS 100% 3.000 4.200 N Olfm2 n/a
4 TRCN0000127405 GCACATCTCGATGCTGGATTA pLKO.1 1579 CDS 100% 10.800 8.640 N Olfm2 n/a
5 TRCN0000447856 CATTCCGGGATCTCCAGTATG pLKO_005 591 CDS 100% 10.800 7.560 N Olfm2 n/a
6 TRCN0000450094 AGCAGACACACGAACCATTGT pLKO_005 754 CDS 100% 4.950 3.465 N Olfm2 n/a
7 TRCN0000187247 CTTCATCAAAGGCCAGAACTT pLKO.1 1084 CDS 100% 4.950 3.465 N OLFM2 n/a
8 TRCN0000127404 CCCAGCTTTCTGTTCTCAGTA pLKO.1 1811 3UTR 100% 4.950 2.970 N Olfm2 n/a
9 TRCN0000373121 TCATCAAAGGCCAGAACTTTA pLKO_005 1086 CDS 100% 13.200 9.240 N OLFM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510293.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04596 pDONR223 100% 83% 89% None (many diffs) n/a
2 ccsbBroad304_04596 pLX_304 0% 83% 89% V5 (many diffs) n/a
Download CSV