Transcript: Mouse XM_006510296.3

PREDICTED: Mus musculus dpy-19-like 1 (C. elegans) (Dpy19l1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dpy19l1 (244745)
Length:
3481
CDS:
1..2241

Additional Resources:

NCBI RefSeq record:
XM_006510296.3
NBCI Gene record:
Dpy19l1 (244745)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510296.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422369 ATGCATCGTCTTTGGTAATTA pLKO_005 1148 CDS 100% 15.000 21.000 N Dpy19l1 n/a
2 TRCN0000416428 CTTACTCAGATTGCATCATTA pLKO_005 1000 CDS 100% 13.200 10.560 N Dpy19l1 n/a
3 TRCN0000414729 ACTCTTACTTCAAGACTATTG pLKO_005 416 CDS 100% 10.800 8.640 N Dpy19l1 n/a
4 TRCN0000216041 CATCGTCTTTGGTAATTATTT pLKO.1 1151 CDS 100% 15.000 10.500 N Dpy19l1 n/a
5 TRCN0000177075 GCTGTTGTCTTTGCTATATTA pLKO.1 1720 CDS 100% 15.000 10.500 N Dpy19l1 n/a
6 TRCN0000415063 ATGTTGCTTGTGACCCATATT pLKO_005 883 CDS 100% 13.200 9.240 N Dpy19l1 n/a
7 TRCN0000182497 GTGGTGAACCACCCACATTAT pLKO.1 1921 CDS 100% 13.200 9.240 N Dpy19l1 n/a
8 TRCN0000176789 CACAAGAAGAACTCATAGAAT pLKO.1 1814 CDS 100% 5.625 3.938 N Dpy19l1 n/a
9 TRCN0000176609 CCTCTAACAATTCCCTTCATA pLKO.1 2816 3UTR 100% 5.625 3.938 N Dpy19l1 n/a
10 TRCN0000200249 CAGGTCTAAGAGCCAGAACAA pLKO.1 1949 CDS 100% 4.950 3.465 N Dpy19l1 n/a
11 TRCN0000178228 GCAACATCTTGGTGAAGGATT pLKO.1 2153 CDS 100% 4.950 3.465 N Dpy19l1 n/a
12 TRCN0000182342 GCCTCACTTTACCACAGTGTT pLKO.1 2178 CDS 100% 4.950 3.465 N Dpy19l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510296.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.