Transcript: Mouse XM_006510666.2

PREDICTED: Mus musculus angiomotin-like 1 (Amotl1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Amotl1 (75723)
Length:
8954
CDS:
111..3128

Additional Resources:

NCBI RefSeq record:
XM_006510666.2
NBCI Gene record:
Amotl1 (75723)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510666.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253005 CTAAACCCAAGCCTCATATAA pLKO_005 5854 3UTR 100% 15.000 21.000 N Amotl1 n/a
2 TRCN0000253003 GGACATGGAGTACACTATTAA pLKO_005 2501 CDS 100% 15.000 10.500 N Amotl1 n/a
3 TRCN0000267461 CCAAGCTCGAAGGCGAGATAA pLKO_005 1759 CDS 100% 13.200 9.240 N Amotl1 n/a
4 TRCN0000253006 GAACCAAGATCACGGTCTTTA pLKO_005 1235 CDS 100% 13.200 9.240 N Amotl1 n/a
5 TRCN0000253004 CAACAGTGGACAGGCGCATAA pLKO_005 974 CDS 100% 10.800 7.560 N Amotl1 n/a
6 TRCN0000420335 CAACAGTGGACAGGCGCATAA pLKO_005 974 CDS 100% 10.800 7.560 N AMOTL1 n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7855 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510666.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.