Transcript: Mouse XM_006510704.3

PREDICTED: Mus musculus B cell CLL/lymphoma 9-like (Bcl9l), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bcl9l (80288)
Length:
5409
CDS:
361..4845

Additional Resources:

NCBI RefSeq record:
XM_006510704.3
NBCI Gene record:
Bcl9l (80288)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510704.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277504 ATGCAAAGGGTGCCCGGATTT pLKO_005 2173 CDS 100% 10.800 15.120 N Bcl9l n/a
2 TRCN0000277505 CTCCGTCACAGTTCGTCTATG pLKO_005 1058 CDS 100% 10.800 15.120 N Bcl9l n/a
3 TRCN0000277573 GAATCGGGCTCTGCTCCATTT pLKO_005 5047 3UTR 100% 10.800 8.640 N Bcl9l n/a
4 TRCN0000178327 GCATTCCTGAGTTCGACTTAT pLKO.1 4304 CDS 100% 13.200 9.240 N Bcl9l n/a
5 TRCN0000277575 GCATTCCTGAGTTCGACTTAT pLKO_005 4304 CDS 100% 13.200 9.240 N Bcl9l n/a
6 TRCN0000198999 GCTTCTGTCTCCCTTTGTCTT pLKO.1 5116 3UTR 100% 4.950 3.465 N Bcl9l n/a
7 TRCN0000033511 GCATCTCATGAACCTGCAGAA pLKO.1 4416 CDS 100% 4.050 2.835 N BCL9L n/a
8 TRCN0000181551 GCCTCATTTCCTTTCCCTACT pLKO.1 5291 3UTR 100% 4.050 2.835 N Bcl9l n/a
9 TRCN0000198681 CTCATGAACCTGCAGAACATG pLKO.1 4420 CDS 100% 4.950 2.970 N Bcl9l n/a
10 TRCN0000277574 CTCATGAACCTGCAGAACATG pLKO_005 4420 CDS 100% 4.950 2.970 N Bcl9l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510704.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.