Transcript: Mouse XM_006510779.3

PREDICTED: Mus musculus acidic (leucine-rich) nuclear phosphoprotein 32 family, member A (Anp32a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Anp32a (11737)
Length:
2051
CDS:
161..862

Additional Resources:

NCBI RefSeq record:
XM_006510779.3
NBCI Gene record:
Anp32a (11737)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510779.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077168 CCGGTTTGTAAATAGCAACCA pLKO.1 1331 3UTR 100% 2.640 3.696 N Anp32a n/a
2 TRCN0000077172 GCATCTAAATTTAAGTGGCAA pLKO.1 391 CDS 100% 2.640 3.696 N Anp32a n/a
3 TRCN0000304254 ACTCAAGAAGCTTGAATTAAG pLKO_005 313 CDS 100% 13.200 9.240 N Anp32a n/a
4 TRCN0000304302 CTGGATAACTGTAAGTCAATT pLKO_005 188 CDS 100% 13.200 9.240 N Anp32a n/a
5 TRCN0000304255 TGGCTTGGAGGTCTAACATTT pLKO_005 1172 3UTR 100% 13.200 9.240 N Anp32a n/a
6 TRCN0000077171 GAGGATGAGGAAGGTTACAAT pLKO.1 737 CDS 100% 5.625 3.938 N Anp32a n/a
7 TRCN0000301294 GAGGATGAGGAAGGTTACAAT pLKO_005 737 CDS 100% 5.625 3.938 N Anp32a n/a
8 TRCN0000006902 CCTATTGTGATTTGACTGTTT pLKO.1 887 3UTR 100% 4.950 3.465 N ANP32A n/a
9 TRCN0000280011 CCTATTGTGATTTGACTGTTT pLKO_005 887 3UTR 100% 4.950 3.465 N ANP32A n/a
10 TRCN0000077169 CCTGGAAGTATTGGCAGAGAA pLKO.1 355 CDS 100% 4.950 3.465 N Anp32a n/a
11 TRCN0000301224 CCTGGAAGTATTGGCAGAGAA pLKO_005 355 CDS 100% 4.950 3.465 N Anp32a n/a
12 TRCN0000222726 GTCATGTACCTCGATGGCTAT pLKO.1 542 CDS 100% 4.050 2.835 N Anp32a n/a
13 TRCN0000120719 GATGAGTTTGAAGAACTGGAA pLKO.1 233 CDS 100% 2.640 1.848 N Anp32-ps n/a
14 TRCN0000120720 CATTTCCAACTTACCAAAGTT pLKO.1 286 CDS 100% 0.563 0.394 N Anp32-ps n/a
15 TRCN0000120721 CAAACTCAAGAAGCTTGAATT pLKO.1 310 CDS 100% 0.000 0.000 N Anp32-ps n/a
16 TRCN0000165589 GAGGAAGATGAGGATGAGGTT pLKO.1 623 CDS 100% 2.640 1.320 Y GPIHBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510779.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11255 pDONR223 100% 78.4% 79.1% None (many diffs) n/a
2 ccsbBroad304_11255 pLX_304 0% 78.4% 79.1% V5 (many diffs) n/a
Download CSV