Transcript: Mouse XM_006510788.1

PREDICTED: Mus musculus branched chain ketoacid dehydrogenase E1, beta polypeptide (Bckdhb), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bckdhb (12040)
Length:
966
CDS:
60..686

Additional Resources:

NCBI RefSeq record:
XM_006510788.1
NBCI Gene record:
Bckdhb (12040)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339175 TTCGCAAGATGATCAACTATT pLKO_005 664 CDS 100% 13.200 18.480 N Bckdhb n/a
2 TRCN0000041398 GCAACGAACTGTCATGGATAT pLKO.1 787 3UTR 100% 10.800 8.640 N Bckdhb n/a
3 TRCN0000374433 CATGACCAGACATGGAAATAT pLKO_005 709 3UTR 100% 15.000 10.500 N Bckdhb n/a
4 TRCN0000339109 GTCATCGATCTGCGGACAATT pLKO_005 408 CDS 100% 13.200 9.240 N Bckdhb n/a
5 TRCN0000041402 CCAGGAAGAATGTTTCTTGAA pLKO.1 542 CDS 100% 4.950 3.465 N Bckdhb n/a
6 TRCN0000041400 CCTCACATCTTTGAGCCCTTT pLKO.1 609 CDS 100% 4.050 2.835 N Bckdhb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.