Transcript: Mouse XM_006510927.3

PREDICTED: Mus musculus stromal antigen 1 (Stag1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stag1 (20842)
Length:
5776
CDS:
1886..4264

Additional Resources:

NCBI RefSeq record:
XM_006510927.3
NBCI Gene record:
Stag1 (20842)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510927.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109016 CCATTCAGAATCGAGTTGATA pLKO.1 2433 CDS 100% 5.625 7.875 N Stag1 n/a
2 TRCN0000109018 CCGGCCTCCATCAACAAATAA pLKO.1 537 5UTR 100% 15.000 10.500 N Stag1 n/a
3 TRCN0000448553 ACTACATGAAGTATTACAATG pLKO_005 3162 CDS 100% 10.800 7.560 N Stag1 n/a
4 TRCN0000109019 GCTCTGGTGAATGTTGCTTTA pLKO.1 1108 5UTR 100% 10.800 7.560 N Stag1 n/a
5 TRCN0000447331 AGAGGATTTGTTGGTATTGAG pLKO_005 2764 CDS 100% 4.950 3.465 N Stag1 n/a
6 TRCN0000142643 GTCTGGATAACACATGGCTAA pLKO.1 3765 CDS 100% 4.050 2.835 N STAG1 n/a
7 TRCN0000109017 GCAGCTATCATAGAAGATGAT pLKO.1 4217 CDS 100% 0.495 0.347 N Stag1 n/a
8 TRCN0000144850 GCAGCTATCATAGAAGATGAT pLKO.1 4217 CDS 100% 0.495 0.347 N STAG1 n/a
9 TRCN0000145197 GCAGAATTGAAGCTGGAATTA pLKO.1 587 5UTR 100% 13.200 9.240 N STAG1 n/a
10 TRCN0000343942 GCAGAATTGAAGCTGGAATTA pLKO_005 587 5UTR 100% 13.200 9.240 N STAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510927.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.