Transcript: Mouse XM_006511247.2

PREDICTED: Mus musculus enhancer of mRNA decapping 3 (Edc3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Edc3 (353190)
Length:
3041
CDS:
392..1369

Additional Resources:

NCBI RefSeq record:
XM_006511247.2
NBCI Gene record:
Edc3 (353190)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511247.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249228 TTTGAGGAGATCGACACTTAC pLKO_005 497 CDS 100% 10.800 8.640 N Edc3 n/a
2 TRCN0000196021 GCCTCCATTAAACTGGAGCTT pLKO.1 1613 3UTR 100% 0.264 0.211 N Edc3 n/a
3 TRCN0000216697 CAAGATGCTGGAGTCTATTAC pLKO.1 958 CDS 100% 13.200 9.240 N Edc3 n/a
4 TRCN0000249226 TCAAGATGCTGGAGTCTATTA pLKO_005 957 CDS 100% 13.200 9.240 N Edc3 n/a
5 TRCN0000249229 TTGGTGCTTCTACCATCATTT pLKO_005 2106 3UTR 100% 13.200 9.240 N Edc3 n/a
6 TRCN0000249225 CGAGTGCTTTGGAGACGATAT pLKO_005 409 CDS 100% 10.800 7.560 N Edc3 n/a
7 TRCN0000180933 GAAGTTGAACAGGGCATTGAT pLKO.1 1184 CDS 100% 5.625 3.938 N Edc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511247.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04178 pDONR223 100% 57% 61.8% None (many diffs) n/a
2 ccsbBroad304_04178 pLX_304 0% 57% 61.8% V5 (many diffs) n/a
Download CSV