Transcript: Mouse XM_006511506.3

PREDICTED: Mus musculus nicotinamide nucleotide adenylyltransferase 3 (Nmnat3), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nmnat3 (74080)
Length:
957
CDS:
269..649

Additional Resources:

NCBI RefSeq record:
XM_006511506.3
NBCI Gene record:
Nmnat3 (74080)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511506.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366158 ATATGCACCTGCGCTTGTTTG pLKO_005 327 CDS 100% 10.800 15.120 N Nmnat3 n/a
2 TRCN0000111521 CGTCAATGACAGCTATGGGAA pLKO.1 412 CDS 100% 2.640 2.112 N Nmnat3 n/a
3 TRCN0000366219 GCATCATCTCACCCGTCAATG pLKO_005 399 CDS 100% 10.800 7.560 N Nmnat3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511506.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05519 pDONR223 100% 30.5% 28.9% None (many diffs) n/a
2 ccsbBroad304_05519 pLX_304 0% 30.5% 28.9% V5 (many diffs) n/a
Download CSV