Transcript: Mouse XM_006511557.3

PREDICTED: Mus musculus IQ motif containing H (Iqch), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Iqch (78250)
Length:
6742
CDS:
131..2938

Additional Resources:

NCBI RefSeq record:
XM_006511557.3
NBCI Gene record:
Iqch (78250)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511557.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251886 ATCCGACGCTGGGTCTTTAAA pLKO_005 2189 CDS 100% 15.000 21.000 N Iqch n/a
2 TRCN0000251887 GGATAAGGTTCAGCGGTTAAT pLKO_005 625 CDS 100% 13.200 10.560 N Iqch n/a
3 TRCN0000251890 ATGCCAGTAAAGGCGTCTTAA pLKO_005 735 CDS 100% 13.200 9.240 N Iqch n/a
4 TRCN0000251889 GGACCTCCAGGAGGACTATTA pLKO_005 1575 CDS 100% 13.200 9.240 N Iqch n/a
5 TRCN0000251888 GTTTGCTTTGCAATTAGTATA pLKO_005 2970 3UTR 100% 13.200 9.240 N Iqch n/a
6 TRCN0000127659 CCCAGACTTCTTAGCATTCAA pLKO.1 1084 CDS 100% 5.625 3.938 N IQCH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511557.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.